Regulog FruR2 - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By TF family - LacI
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 4 | 2 |
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | 4 | 2 |
| Leptothrix cholodnii SP-6 | ||
| Methylibium petroleiphilum PM1 | ||
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | ||
| Verminephrobacter eiseniae EF01-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| fruR2 |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -206 score = 4.3283 sequence = ATTTGGTATCGATTCCAGAC Site: position = -16 score = 4.02907 sequence = TCATGGAATCGTTACCATGC Gene: Aave_4253: Transcriptional regulator for fructose utilization, LacI family |
|
|
*
Delftia acidovorans SPH-1 Site: position = -127 score = 5.23354 sequence = TTTTGGGAACGTTCCCAACC Site: position = -17 score = 4.50315 sequence = CAACGGGAACGATTGCATTG Gene: Daci_2662: Transcriptional regulator for fructose utilization, LacI family |
|
|
|
|
|
|
|
Transcriptional regulator for fructose utilization, LacI family |
| CRON 2. | ||||||||||||
| fruB |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -225 score = 4.02907 sequence = GCATGGTAACGATTCCATGA Site: position = -35 score = 4.3283 sequence = GTCTGGAATCGATACCAAAT Gene: Aave_4252: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
*
Delftia acidovorans SPH-1 Site: position = -108 score = 4.50315 sequence = CAATGCAATCGTTCCCGTTG Site: position = 2 score = 5.23354 sequence = GGTTGGGAACGTTCCCAAAA Gene: Daci_2663: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
|
|
|
|
|
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| fruK |
Gene: Aave_4251: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
Gene: Daci_2664: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
|
|
|
|
|
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
Gene: Aave_4250: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
Gene: Daci_2665: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
|
|
|
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |