Regulog CueR2 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | 2 | 1 |
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | 2 | 1 |
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | 2 | 1 |
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| cueR2 |
|
*
Shewanella putrefaciens CN-32 Site: position = -66 score = 6.05367 sequence = AGCTGTGTGTTACACACAGAG Gene: Sputcn32_0271: Copper-responsive transcriptional regulator, MerR family |
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -101 score = 6.03991 sequence = ACATGGGTGTAAGACATAGGT Gene: Sfri_0211: Copper-responsive transcriptional regulator, MerR family |
|
*
Shewanella loihica PV-4 Site: position = -66 score = 6.75103 sequence = ACCTGTGTCTAACACACAGGT Gene: Shew_3819: Copper-responsive transcriptional regulator, MerR family |
|
|
|
|
|
Copper-responsive transcriptional regulator, MerR family |
| copA |
|
Gene: Sputcn32_0270: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
|
Gene: Sfri_0212: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
Gene: Shew_3818: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |