Regulog FruR2 - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructose utilization
Effector:	Fructose-1-phosphate
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Fructose-1-phosphate
By pathway - Fructose utilization

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1	4	2
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
fruR2	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	* Rhodobacter sphaeroides 2.4.1 Site: position = -127 score = 5.47784 sequence = ATGTGGAAACGTTTCCACCA Gene: RSP_1785: Transcriptional regulator for fructose utilization, LacI family	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Transcriptional regulator for fructose utilization, LacI family

CRON 2.
fruB	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	* Rhodobacter sphaeroides 2.4.1 Site: position = -169 score = 4.93225 sequence = ATCCGCAATCGTTTCCACTG Site: position = -60 score = 5.47784 sequence = TGGTGGAAACGTTTCCACAT Gene: RSP_1786: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1787: 1-phosphofructokinase (EC 2.7.1.56)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	1-phosphofructokinase (EC 2.7.1.56)
fruA	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1788: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog FruR2 - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --