Regulog FruR2 - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | 4 | 2 |
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| fruR2 |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -127 score = 5.47784 sequence = ATGTGGAAACGTTTCCACCA Gene: RSP_1785: Transcriptional regulator for fructose utilization, LacI family |
|
|
|
|
|
|
|
Transcriptional regulator for fructose utilization, LacI family |
| CRON 2. | ||||||||||||||||
| fruB |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -169 score = 4.93225 sequence = ATCCGCAATCGTTTCCACTG Site: position = -60 score = 5.47784 sequence = TGGTGGAAACGTTTCCACAT Gene: RSP_1786: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
|
|
|
|
|
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| fruK |
|
|
|
|
|
|
|
Gene: RSP_1787: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
|
|
|
|
|
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
|
|
|
|
|
|
|
Gene: RSP_1788: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
|
|
|
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |