Regulog blr3394 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | 6 | 1 |
| Bradyrhizobium sp. BTAi1 | 6 | 1 |
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| blr3389 |
|
|
|
*
Bradyrhizobium japonicum USDA 110 Site: position = -69 score = 6.93545 sequence = TTTTAGTTGCGCACCTCAAA Gene: blr3389: Sugar ABC transporter, substrate-binding protein |
*
Bradyrhizobium sp. BTAi1 Site: position = -69 score = 6.82117 sequence = TTTTAGTTGCGCACCTCAAT Gene: BBta_3985: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, substrate-binding protein |
| blr3390 |
|
|
|
Gene: blr3390: Sugar ABC transporter, transmembrane component |
Gene: BBta_3986: Sugar ABC transporter, transmembrane component |
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, transmembrane component |
| blr3391 |
|
|
|
Gene: blr3391: Sugar ABC transporter, transmembrane component |
Gene: BBta_3987: Sugar ABC transporter, transmembrane component |
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, transmembrane component |
| COG0673 |
|
|
|
Gene: blr3392: Predicted dehydrogenases and related proteins |
Gene: BBta_3988: Predicted dehydrogenases and related proteins |
|
|
|
|
|
|
|
|
|
|
Predicted dehydrogenases and related proteins |
| COG3828 |
|
|
|
Gene: blr3393: hypothetical protein |
Gene: BBta_3989: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| blr3394 |
|
|
|
Gene: blr3394: Transcriptional regulator, LacI family |
Gene: BBta_3990: Transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
|
Transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |