Regulog QorR - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By trascription factor - QorR
- By TF family - HxlR
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | ||
| Corynebacterium diphtheriae NCTC 13129 | ||
| Corynebacterium efficiens YS-314 | ||
| Corynebacterium glutamicum ATCC 13032 | 2 | 2 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| qorB |
|
|
|
|
*
Corynebacterium glutamicum ATCC 13032 Site: position = -65 score = 6.15017 sequence = GCACTTACTTTTTGATAGTGC Gene: cg1553: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
|
|
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
| CRON 2. | |||||||||
| qorR |
|
|
|
|
*
Corynebacterium glutamicum ATCC 13032 Site: position = -62 score = 6.15017 sequence = GCACTATCAAAAAGTAAGTGC Gene: cg1552: Redox-sensing transcriptional regulator QorR, HxlR family |
|
|
|
Redox-sensing transcriptional regulator QorR, HxlR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |