Regulog EF1676 - Enterococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Enterococcus faecalis V583	3	1
Enterococcus faecium DO

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes			Function

CRON 1.
EF1676	* Enterococcus faecalis V583 Site: position = -46 score = 6.73415 sequence = TATAGTTAGTTACATAAGTAGTTAACCGTT Gene: EF1676: Transcriptional regulator, GntR family	Enterococcus faecium DO	Transcriptional regulator, GntR family
lp_2743	Enterococcus faecalis V583 Gene: EF1675: ABC-type multidrug transport system, ATPase component	Enterococcus faecium DO	ABC-type multidrug transport system, ATPase component
lp_2744	Enterococcus faecalis V583 Gene: EF1674: ABC-type multidrug transport system, permease component	Enterococcus faecium DO	ABC-type multidrug transport system, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --