Regulog UriR - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Nucleoside utilization |
| Effector: | Pyrimidine nucleoside |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - LacI
- By effector - Pyrimidine nucleoside
- By pathway - Nucleoside utilization
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 1 | 1 |
| Listeria monocytogenes EGD-e | 1 | 1 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | 1 | 1 |
| Listeria welshimeri serovar 6b str. SLCC5334 | 1 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| pdp |
*
Listeria innocua Clip11262 Site: position = -89 score = 7.06151 sequence = TTAGTAAAACGGTTTACTTA Gene: lin2101: Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2) |
*
Listeria monocytogenes EGD-e Site: position = -89 score = 7.06151 sequence = TTAGTAAAACGGTTTACTTA Gene: lmo1993: Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2) |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -90 score = 6.76825 sequence = TTAGTAAAACGGTTTACTTG Gene: lse_1975: Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2) |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -89 score = 7.06151 sequence = TTAGTAAAACGGTTTACTTA Gene: lwe2013: Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2) |
Pyrimidine-nucleoside phosphorylase (EC 2.4.2.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |