Regulog FruR2 - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By TF family - LacI
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | 4 | 2 |
| Ralstonia pickettii 12J | 4 | 2 |
| Ralstonia metallidurans CH34 | ||
| Ralstonia eutropha JMP134 | ||
| Ralstonia eutropha H16 | ||
| Cupriavidus taiwanensis |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| fruR2 |
*
Ralstonia solanacearum GMI1000 Site: position = -20 score = 5.44986 sequence = CTTTGGAAACGATTTCAGCG Site: position = -163 score = 6.18685 sequence = GATTGAAATCGATTACATTG Gene: RSc2860: Transcriptional regulator for fructose utilization, LacI family |
*
Ralstonia pickettii 12J Site: position = -153 score = 6.62804 sequence = AATTGAAATCGATTACAGTT Site: position = -19 score = 5.04343 sequence = CTTTGGAAACGATTTCAGCA Gene: Rpic_3107: Transcriptional regulator for fructose utilization, LacI family |
|
|
|
|
Transcriptional regulator for fructose utilization, LacI family |
| CRON 2. | |||||||
| fruB |
*
Ralstonia solanacearum GMI1000 Site: position = -83 score = 6.18685 sequence = CAATGTAATCGATTTCAATC Site: position = -226 score = 5.44986 sequence = CGCTGAAATCGTTTCCAAAG Gene: RSc2861: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
*
Ralstonia pickettii 12J Site: position = -218 score = 5.04343 sequence = TGCTGAAATCGTTTCCAAAG Site: position = -84 score = 6.62804 sequence = AACTGTAATCGATTTCAATT Gene: Rpic_3108: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
|
|
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| fruK |
Gene: RSc2862: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: Rpic_3109: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
|
|
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
Gene: RSc2863: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Gene: Rpic_3110: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |