Regulog RhaR - Mycobacteriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By TF family - LacI
By effector - Rhamnose
By pathway - Rhamnose utilization

Statistics of regulated genes
Genome	Genes	Operons
Mycobacterium abscessus ATCC 19977
Mycobacterium avium 104
Mycobacterium flavescens PYR-GCK
Mycobacterium leprae TN
Mycobacterium marinum M
Mycobacterium smegmatis str. MC2 155	6	1
Mycobacterium sp. JLS	6	1
Mycobacterium tuberculosis H37Rv
Mycobacterium vanbaalenii PYR-1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
rhaM	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	* Mycobacterium smegmatis str. MC2 155 Site: position = -53 score = 7.241 sequence = GAATTGAAACGTTTCAATAC Gene: MSMEG_0587: L-rhamnose mutarotase	* Mycobacterium sp. JLS Site: position = -35 score = 7.05275 sequence = GTATTGAAACGTTTCAACCC Gene: Mjls_4774: L-rhamnose mutarotase	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	L-rhamnose mutarotase
rhaY	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_0588: Predicted L-rhamnose permease RhaY	Mycobacterium sp. JLS Gene: Mjls_4773: Predicted L-rhamnose permease RhaY	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted L-rhamnose permease RhaY
rhaI	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_0589: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)	Mycobacterium sp. JLS Gene: Mjls_4772: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)
rhaEW	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_0590: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)	Mycobacterium sp. JLS Gene: Mjls_4771: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)
rhaB	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_0591: Rhamnulokinase (EC 2.7.1.5)	Mycobacterium sp. JLS Gene: Mjls_4770: Rhamnulokinase (EC 2.7.1.5)	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Rhamnulokinase (EC 2.7.1.5)
rhaR	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_0592: Transcriptional regulator of rhamnose utilization, LacI family	Mycobacterium sp. JLS Gene: Mjls_4769: Transcriptional regulator of rhamnose utilization, LacI family	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Transcriptional regulator of rhamnose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RhaR - Mycobacteriaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --