Regulog RhaR - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By TF family - LacI
- By effector - Rhamnose
- By pathway - Rhamnose utilization
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium abscessus ATCC 19977 | ||
| Mycobacterium avium 104 | ||
| Mycobacterium flavescens PYR-GCK | ||
| Mycobacterium leprae TN | ||
| Mycobacterium marinum M | ||
| Mycobacterium smegmatis str. MC2 155 | 6 | 1 |
| Mycobacterium sp. JLS | 6 | 1 |
| Mycobacterium tuberculosis H37Rv | ||
| Mycobacterium vanbaalenii PYR-1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rhaM |
|
|
|
|
|
*
Mycobacterium smegmatis str. MC2 155 Site: position = -53 score = 7.241 sequence = GAATTGAAACGTTTCAATAC Gene: MSMEG_0587: L-rhamnose mutarotase |
*
Mycobacterium sp. JLS Site: position = -35 score = 7.05275 sequence = GTATTGAAACGTTTCAACCC Gene: Mjls_4774: L-rhamnose mutarotase |
|
|
L-rhamnose mutarotase |
| rhaY |
|
|
|
|
|
Gene: MSMEG_0588: Predicted L-rhamnose permease RhaY |
Gene: Mjls_4773: Predicted L-rhamnose permease RhaY |
|
|
Predicted L-rhamnose permease RhaY |
| rhaI |
|
|
|
|
|
Gene: MSMEG_0589: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
Gene: Mjls_4772: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
|
|
Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
| rhaEW |
|
|
|
|
|
Gene: MSMEG_0590: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: Mjls_4771: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
|
|
Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
| rhaB |
|
|
|
|
|
Gene: MSMEG_0591: Rhamnulokinase (EC 2.7.1.5) |
Gene: Mjls_4770: Rhamnulokinase (EC 2.7.1.5) |
|
|
Rhamnulokinase (EC 2.7.1.5) |
| rhaR |
|
|
|
|
|
Gene: MSMEG_0592: Transcriptional regulator of rhamnose utilization, LacI family |
Gene: Mjls_4769: Transcriptional regulator of rhamnose utilization, LacI family |
|
|
Transcriptional regulator of rhamnose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |