Regulog ScrR - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - LacI
- By effector - Sucrose-6-phosphate
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | ||
| Clostridium beijerincki NCIMB 8052 | 4 | 1 |
| Clostridium botulinum A str. ATCC 3502 | ||
| Clostridium butyricum 5521 | ||
| Clostridium kluyveri DSM 555 | ||
| Clostridium novyi NT | ||
| Clostridium perfringens ATCC 13124 | 4 | 1 |
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| scrA |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -68 score = 6.66501 sequence = ATATGGAACTGGTATCATAT Gene: Cbei_5012: Sucrose specific PTS system, IIABC component (EC 2.7.1.69) |
|
|
|
|
*
Clostridium perfringens ATCC 13124 Site: position = -244 score = 5.93541 sequence = TTATGAAACTAATTCCATAT Site: position = -71 score = 6.66501 sequence = ATATGGAACTGATACCATAT Gene: CPF_1785: Sucrose specific PTS system, IIABC component (EC 2.7.1.69) |
|
Sucrose specific PTS system, IIABC component (EC 2.7.1.69) |
| scrR |
|
Gene: Cbei_5011: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
Gene: CBY_3743: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
|
Gene: CPF_1784: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
Sucrose utilization transcriptional regulator ScrR, LacI family |
| scrB |
|
Gene: Cbei_5010: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Gene: CBY_3744: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
|
Gene: CPF_1783: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
| scrK |
|
Gene: Cbei_5009: Fructokinase (EC 2.7.1.4) |
|
Gene: CBY_3745: Fructokinase (EC 2.7.1.4) |
|
|
Gene: CPF_1782: Fructokinase (EC 2.7.1.4) |
|
Fructokinase (EC 2.7.1.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |