Regulog ScrR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - LacI
- By effector - Sucrose-6-phosphate
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 5 | 2 |
| Aeromonas salmonicida subsp. salmonicida A449 | 5 | 2 |
| Tolumonas auensis DSM 9187 | 3 | 1 |
| Moritella sp. PE36 | ||
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| scrY |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -108 score = 6.50968 sequence = CAGCTGAAACGGTTTAGCTG Site: position = -77 score = 6.22118 sequence = TAGCTAAATTGGTTTAGCTA Gene: AHA_2981: Sucrose-specific outer membrane porin |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -109 score = 5.70573 sequence = TGGCTGAAAGGGTTTAGCTG Site: position = -78 score = 6.97676 sequence = TAGCTAAAACGGTTTAGCTA Gene: ASA_2994: Sucrose-specific outer membrane porin |
|
|
|
|
Sucrose-specific outer membrane porin |
| CRON 2. | |||||||
| scrK |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -66 score = 6.59612 sequence = TGGCTAAAACGGTTTAGCTG Gene: AHA_2980: Fructokinase (EC 2.7.1.4) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -108 score = 6.71088 sequence = TAGCTAAATCGGTTTAGCTG Gene: ASA_2993: Fructokinase (EC 2.7.1.4) |
Gene: Tola_1011: Fructokinase (EC 2.7.1.4) |
|
Gene: Ping_0971: Fructokinase (EC 2.7.1.4) |
|
Fructokinase (EC 2.7.1.4) |
| scrA |
Gene: AHA_2979: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) |
Gene: ASA_2992: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) |
*
Tolumonas auensis DSM 9187 Site: position = -330 score = 6.14449 sequence = TTGCTAAAACGGTTTAGCGA Site: position = -299 score = 6.32822 sequence = TAGCTAAACCGTTTTAGTAA Gene: Tola_0815: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) |
|
|
|
PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) |
| scrB |
Gene: AHA_2978: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Gene: ASA_2991: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Gene: Tola_0814: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Gene: Ping_0974: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
| scrR |
Gene: AHA_2977: Sucrose operon repressor ScrR, LacI family |
Gene: ASA_2990: Sucrose operon repressor ScrR, LacI family |
Gene: Tola_0813: Sucrose operon repressor ScrR, LacI family |
|
|
|
Sucrose operon repressor ScrR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |