Regulog IolR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By pathway - Inositol utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 10 | 2 |
| Arthrobacter chlorophenolicus A6 | 7 | 4 |
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| iolR |
*
Arthrobacter aurescens TC1 Site: position = -91 score = 6.42979 sequence = ATTTTGTAGCGCTACAATTT Gene: AAur_1987: Transcriptional regulator for inositol utilization, LacI family |
*
Arthrobacter chlorophenolicus A6 Site: position = -66 score = 5.60022 sequence = TGTTTGGAGCGCTCCATAAA Gene: Achl_0116: Transcriptional regulator for inositol utilization, LacI family |
|
|
|
|
|
|
|
|
|
|
|
|
Transcriptional regulator for inositol utilization, LacI family |
| inoC |
Gene: AAur_1988: Predicted inositol ABC transport system, sugar-binding protein |
*
Arthrobacter chlorophenolicus A6 Site: position = -104 score = 5.67965 sequence = TTCATGGAGCGCTCCAAATG Gene: Achl_0113: Predicted inositol ABC transport system, sugar-binding protein |
Gene: Arth_0830: Predicted inositol ABC transport system, sugar-binding protein |
|
|
|
|
|
|
|
|
|
Gene: RSal33209_3164: Predicted inositol ABC transport system, sugar-binding protein |
|
Predicted inositol ABC transport system, sugar-binding protein |
| inoB |
Gene: AAur_1989: Predicted inositol ABC transport system, permease protein |
Gene: Achl_0114: Predicted inositol ABC transport system, permease protein |
Gene: Arth_0831: Predicted inositol ABC transport system, permease protein |
|
|
|
|
|
|
|
|
|
Gene: RSal33209_3163: Predicted inositol ABC transport system, permease protein |
|
Predicted inositol ABC transport system, permease protein |
| inoC |
Gene: AAur_1990: Predicted inositol ABC transport system, ATP-binding protein |
Gene: Achl_0115: Predicted inositol ABC transport system, ATP-binding protein |
Gene: Arth_0832: Predicted inositol ABC transport system, ATP-binding protein |
|
|
|
|
|
|
|
|
|
Gene: RSal33209_3162: Predicted inositol ABC transport system, ATP-binding protein |
|
Predicted inositol ABC transport system, ATP-binding protein |
| iolG1 |
Gene: AAur_1992: putative myo-inositol 2-dehydrogenase |
|
|
|
Gene: Bfae_26160: putative myo-inositol 2-dehydrogenase |
|
|
Gene: JNB_03620: putative myo-inositol 2-dehydrogenase |
|
|
|
|
|
|
putative myo-inositol 2-dehydrogenase |
| iolG2 |
Gene: AAur_1993: putative myo-inositol 2-dehydrogenase |
|
Gene: Arth_0833: putative myo-inositol 2-dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
putative myo-inositol 2-dehydrogenase |
| iolG3 |
Gene: AAur_1994: putative myo-inositol 2-dehydrogenase |
|
Gene: Arth_0834: putative myo-inositol 2-dehydrogenase |
|
|
|
|
|
|
|
|
|
Gene: RSal33209_3165: putative myo-inositol 2-dehydrogenase |
|
putative myo-inositol 2-dehydrogenase |
| iolG4 |
*
Arthrobacter aurescens TC1 Site: position = 44 score = 6.42979 sequence = AAATTGTAGCGCTACAAAAT Gene: AAur_1986: putative myo-inositol 2-dehydrogenase |
*
Arthrobacter chlorophenolicus A6 Site: position = -90 score = 5.60022 sequence = TTTATGGAGCGCTCCAAACA Gene: Achl_0117: putative myo-inositol 2-dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
|
putative myo-inositol 2-dehydrogenase |
| iolE |
Gene: AAur_1985: Inosose dehydratase (EC 4.2.1.44) |
Gene: Achl_0119: Inosose dehydratase (EC 4.2.1.44) |
|
|
|
|
|
|
|
|
|
|
|
|
Inosose dehydratase (EC 4.2.1.44) |
| iolG5 |
Gene: AAur_1984: putative myo-inositol 2-dehydrogenase |
*
Arthrobacter chlorophenolicus A6 Site: position = -18 score = 6.18191 sequence = TTATTGGAGCGCTCCATAAT Gene: Achl_0112: putative myo-inositol 2-dehydrogenase |
Gene: Arth_1058: putative myo-inositol 2-dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
putative myo-inositol 2-dehydrogenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |