Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog CadR-PbrR - Desulfuromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Geobacter metallireducens GS-15
Geobacter sulfurreducens PCA
Geobacter uraniumreducens Rf4
Geobacter sp. FRC-32
Geobacter sp. M21
Geobacter lovleyi SZ
Pelobacter propionicus DSM 2379 1 1
Pelobacter carbinolicus str. DSM 2380
Desulfuromonas acetoxidans DSM 684
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cadA
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
*
Pelobacter propionicus DSM 2379

Site:
position = -56
score = 5.12529
sequence = ACCCTGAAGTGGGTACAGGCT

Gene: Ppro_0832: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD