Regulog CadR-PbrR - Desulfuromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Geobacter metallireducens GS-15
Geobacter sulfurreducens PCA
Geobacter uraniumreducens Rf4
Geobacter sp. FRC-32
Geobacter sp. M21
Geobacter lovleyi SZ
Pelobacter propionicus DSM 2379	1	1
Pelobacter carbinolicus str. DSM 2380
Desulfuromonas acetoxidans DSM 684

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
cadA	Geobacter metallireducens GS-15	Geobacter sulfurreducens PCA	Geobacter uraniumreducens Rf4	Geobacter sp. FRC-32	Geobacter sp. M21	Geobacter lovleyi SZ	* Pelobacter propionicus DSM 2379 Site: position = -56 score = 5.12529 sequence = ACCCTGAAGTGGGTACAGGCT Gene: Ppro_0832: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	Pelobacter carbinolicus str. DSM 2380	Desulfuromonas acetoxidans DSM 684	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --