Regulog CadR-PbrR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | 2 | 2 |
| Dechloromonas aromatica RCB | 3 | 2 |
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Chromobacterium violaceum ATCC 12472 | 1 | 1 |
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | 1 | 1 |
| Methylobacillus flagellatus KT | 1 | 1 |
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| czcD |
|
|
|
|
|
|
|
|
|
*
Methylobacillus flagellatus KT Site: position = -16 score = 5.34584 sequence = ACCCTCTAGTAACTTGATGGT Gene: Mfla_0694: Co/Zn/Cd efflux protein |
|
|
Co/Zn/Cd efflux protein |
| CRON 2. | |||||||||||||
| cadA |
|
*2
Thauera sp. MZ1T Site: position = -57 score = 5.3799 sequence = ACTCTGTAGTGACTACGGATT Gene: Tmz1t_2103: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -57 score = 5.3799 sequence = ACTCTGTAGTGACTACGGATT Gene: Tmz1t_2390: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*2
Dechloromonas aromatica RCB Site: position = -58 score = 6.52076 sequence = ACCCTATAGTAGCTACAGGGT Gene: Daro_2257: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -49 score = 5.63405 sequence = ACTCTGTAGCCACTCAAGGGT Gene: Daro_2631: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -154 score = 6.70483 sequence = ACCCTGTAGTGACTACAGGGT Gene: CV1154: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*
Laribacter hongkongensis HLHK9 Site: position = -48 score = 6.24161 sequence = ACCCTATAGTAGCTCCAGGGT Gene: LHK_00449: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| lspA |
|
|
Gene: Daro_2630: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |