Regulog CadR-PbrR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 1 | 1 |
| Acidovorax sp. JS42 | 9 | 5 |
| Comamonas testosteroni KF-1 | 7 | 5 |
| Delftia acidovorans SPH-1 | 3 | 2 |
| Polaromonas naphthalenivorans CJ2 | 1 | 1 |
| Polaromonas sp. JS666 | 1 | 1 |
| Rhodoferax ferrireducens DSM 15236 | 1 | 1 |
| Variovorax paradoxus S110 | 1 | 1 |
| Verminephrobacter eiseniae EF01-2 | 2 | 2 |
| Methylibium petroleiphilum PM1 | 6 | 2 |
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| cadA |
|
|
|
|
|
|
*
Rhodoferax ferrireducens DSM 15236 Site: position = -54 score = 5.73069 sequence = ACTCTATACCTACTATAGGGT Gene: Rfer_0854: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| CRON 2. | ||||||||||||
| cadA |
|
|
*
Comamonas testosteroni KF-1 Site: position = -150 score = 4.73255 sequence = ACTCTCAATCTGCTTTAGGGT Gene: CtesDRAFT_1793: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Delftia acidovorans SPH-1 Site: position = -274 score = 5.73634 sequence = ACCTTGGAGCTACTCCAAGGT Gene: Daci_0479: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| lspA |
|
|
Gene: CtesDRAFT_1792: Lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: Daci_0480: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 3. | ||||||||||||
| cadA |
|
*
Acidovorax sp. JS42 Site: position = -61 score = 6.29717 sequence = ACTCTATAGTAACTATAGAGT Gene: Ajs_1242: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Comamonas testosteroni KF-1 Site: position = -61 score = 6.30565 sequence = ACTCTATAGTAGCTATAGGGT Gene: CtesDRAFT_2650: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| lspA |
|
Gene: Ajs_1243: Lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: CtesDRAFT_2649: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 4. | ||||||||||||
| pbrT |
|
Gene: Ajs_1240: Pb(II) uptake protein, ILT family |
2
Comamonas testosteroni KF-1 Gene: CtesDRAFT_1706: Pb(II) uptake protein, ILT family Gene: CtesDRAFT_1790: Pb(II) uptake protein, ILT family |
Gene: Daci_0482: Pb(II) uptake protein, ILT family |
|
|
|
|
|
*
Methylibium petroleiphilum PM1 Site: position = -78 score = 5.38839 sequence = ACCCTGTAGTGGCTACGGACT Gene: Mpe_A2353: Pb(II) uptake protein, ILT family |
|
Pb(II) uptake protein, ILT family |
| PF04116 |
|
|
|
|
|
|
|
|
|
Gene: Mpe_A2354: Sterol desaturase |
|
Sterol desaturase |
| czcD |
|
|
|
|
|
|
|
|
|
Gene: Mpe_A2355: Co/Zn/Cd efflux protein |
|
Co/Zn/Cd efflux protein |
| czcC |
|
|
|
|
|
|
|
|
|
Gene: Mpe_A2356: Heavy metal efflux RND outer membrane protein |
|
Heavy metal efflux RND outer membrane protein |
| pbrR |
|
*
Acidovorax sp. JS42 Site: position = -54 score = 6.29717 sequence = ACTCTATAGTTACTATAGAGT Gene: Ajs_1241: Lead resistance transcriptional regulator, MerR family |
*
Comamonas testosteroni KF-1 Site: position = -44 score = 6.30565 sequence = ACCCTATAGCTACTATAGAGT Gene: CtesDRAFT_2651: Lead resistance transcriptional regulator, MerR family |
|
|
|
|
|
|
|
|
Lead resistance transcriptional regulator, MerR family |
| CRON 5. | ||||||||||||
| cadA |
|
*
Acidovorax sp. JS42 Site: position = -34 score = 5.49138 sequence = ACTCTATACCCACTTCAGGGT Gene: Ajs_1335: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Comamonas testosteroni KF-1 Site: position = -55 score = 5.79306 sequence = ACTCTATACCAACTACAGGGT Gene: CtesDRAFT_1695: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*
Polaromonas naphthalenivorans CJ2 Site: position = -50 score = 4.92512 sequence = ACCTTCAAGTGGGTTCAGGGT Gene: Pnap_4001: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
*
Variovorax paradoxus S110 Site: position = -26 score = 4.82998 sequence = ACTCTACACCTGCTTCAGGGT Gene: Vapar_3562: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| PF01841 |
|
Gene: Ajs_1334: Transglutaminase-like protein |
|
|
|
|
|
|
|
|
|
Transglutaminase-like protein |
| CRON 6. | ||||||||||||
| cadA |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -328 score = 5.21158 sequence = ACCTTGAAGCGGCTTGAAGGT Gene: Aave_1815: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Acidovorax sp. JS42 Site: position = -34 score = 5.7138 sequence = ACCTTGGAGTGGCTTCAAGGT Gene: Ajs_2594: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Comamonas testosteroni KF-1 Site: position = -34 score = 5.02186 sequence = ACCTTGAAGTGACTTTATTGT Gene: CtesDRAFT_0050: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Delftia acidovorans SPH-1 Site: position = -34 score = 4.94754 sequence = ACCTTGAAGTGACTTCACCGT Gene: Daci_2915: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| CRON 7. | ||||||||||||
| czcD |
|
*
Acidovorax sp. JS42 Site: position = -61 score = 5.24334 sequence = ACATTATAGCTACTATATAGT Gene: Ajs_3474: Co/Zn/Cd efflux protein |
|
|
|
*
Polaromonas sp. JS666 Site: position = -60 score = 5.28308 sequence = ACCTTGAAGTGGGTCCAGGGT Gene: Bpro_3481: Co/Zn/Cd efflux protein |
|
|
*2
Verminephrobacter eiseniae EF01-2 Site: position = -57 score = 6.24161 sequence = ACCCTAGAGTTGCTACAGGGT Gene: Veis_2983: Co/Zn/Cd efflux protein Site: position = -68 score = 4.68292 sequence = ACCATCGATCGACTCCAGGGT Gene: Veis_1666: Co/Zn/Cd efflux protein |
*
Methylibium petroleiphilum PM1 Site: position = -55 score = 6.00699 sequence = ACTCTGGAGCAGCTACAGGGT Gene: Mpe_A1655: Co/Zn/Cd efflux protein |
|
Co/Zn/Cd efflux protein |
| lspA |
|
Gene: Ajs_3473: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| PF01841 |
|
|
|
|
|
|
|
|
|
Gene: Mpe_A1654: Transglutaminase-like protein |
|
Transglutaminase-like protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |