Regulog CadR-PbrR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | 1 | 1 |
| Burkholderia mallei ATCC 23344 | 1 | 1 |
| Burkholderia sp. 383 | 1 | 1 |
| Burkholderia cepacia AMMD | 1 | 1 |
| Burkholderia vietnamiensis G4 | 1 | 1 |
| Burkholderia glumae BGR1 | 1 | 1 |
| Burkholderia xenovorans LB400 | 21 | 8 |
| Burkholderia phymatum STM815 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| cadA |
*
Burkholderia pseudomallei K96243 Site: position = -57 score = 6.41634 sequence = ACCTTGTAGTGACTACAAGGT Gene: BPSL3378: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Burkholderia mallei ATCC 23344 Site: position = -414 score = 6.41634 sequence = ACCTTGTAGTGACTACAAGGT Gene: BMA2976: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Burkholderia sp. 383 Site: position = -57 score = 6.13719 sequence = ACCTTGTAGTGGCTTCAGGGT Gene: Bcep18194_A3304: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Burkholderia cepacia AMMD Site: position = -622 score = 6.13719 sequence = ACCTTGTAGTGGCTTCAGGGT Gene: Bamb_0114: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Burkholderia vietnamiensis G4 Site: position = -517 score = 6.13719 sequence = ACCTTGTAGTGGCTTCAGGGT Gene: Bcep1808_0131: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Burkholderia glumae BGR1 Site: position = -57 score = 5.85805 sequence = ACCTTGAAGTGGCTTCAGGGT Gene: bglu_1g00910: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Burkholderia xenovorans LB400 Site: position = -353 score = 5.99294 sequence = ACCTTGTAGTGGCTTCAAGGT Gene: Bxe_A4439: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| CRON 2. | |||||||||
| czcD |
|
|
|
|
|
|
*7
Burkholderia xenovorans LB400 Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_B2911: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_C0883: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_B1605: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_C0391: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_A1118: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_A2903: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Bxe_A1104: Co/Zn/Cd efflux protein |
|
Co/Zn/Cd efflux protein |
| lspA |
|
|
|
|
|
|
7
Burkholderia xenovorans LB400 Gene: Bxe_B1606: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Bxe_B2910: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Bxe_C0884: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Bxe_C0390: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Bxe_A1119: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Bxe_A2904: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Bxe_A1105: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| tnpA |
|
|
|
|
|
|
6
Burkholderia xenovorans LB400 Gene: Bxe_B1607: Transposase Gene: Bxe_C0389: Transposase Gene: Bxe_B2909: Transposase Gene: Bxe_C0885: Transposase Gene: Bxe_A2905: Transposase Gene: Bxe_A1106: Transposase |
|
Transposase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |