Regulog CadR-PbrR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Tolumonas auensis DSM 9187 | 1 | 1 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| cadA |
|
|
|
|
|
*
Tolumonas auensis DSM 9187 Site: position = -78 score = 6.665 sequence = ACCCTGTAGTTACTATAGGGT Gene: Tola_1749: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |