Regulog CueR - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | ||
| Erythrobacter sp. NAP1 | ||
| Novosphingobium aromaticivorans DSM 12444 | 3 | 1 |
| Sphingopyxis alaskensis RB2256 | ||
| Sphingobium japonicum UT26S | ||
| Sphingomonas wittichii RW1 | ||
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| copA |
|
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -53 score = 5.12449 sequence = ACCCTGACATGATGTCAAGGT Gene: Saro_2142: Copper-translocating P-type ATPase (EC 3.6.3.4) |
3
Sphingopyxis alaskensis RB2256 Gene: Sala_2453: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: Sala_2429: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: Sala_2544: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SJA_C1-04830: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| PF11666 |
|
|
Gene: Saro_2143: hypothetical protein |
|
Gene: SJA_C1-04760: hypothetical protein |
|
|
hypothetical protein |
| cueR |
|
|
Gene: Saro_2144: Copper-responsive transcriptional regulator, MerR family |
Gene: Sala_2543: Copper-responsive transcriptional regulator, MerR family |
Gene: SJA_C1-04820: Copper-responsive transcriptional regulator, MerR family |
|
|
Copper-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |