Regulog CueR - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444	3	1
Sphingopyxis alaskensis RB2256
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1
Zymomonas mobilis subsp. mobilis ZM4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
copA	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	* Novosphingobium aromaticivorans DSM 12444 Site: position = -53 score = 5.12449 sequence = ACCCTGACATGATGTCAAGGT Gene: Saro_2142: Copper-translocating P-type ATPase (EC 3.6.3.4)	3 Sphingopyxis alaskensis RB2256 Gene: Sala_2453: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: Sala_2429: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: Sala_2544: Copper-translocating P-type ATPase (EC 3.6.3.4)	Sphingobium japonicum UT26S Gene: SJA_C1-04830: Copper-translocating P-type ATPase (EC 3.6.3.4)	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Copper-translocating P-type ATPase (EC 3.6.3.4)
PF11666	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2143: hypothetical protein	Sphingopyxis alaskensis RB2256	Sphingobium japonicum UT26S Gene: SJA_C1-04760: hypothetical protein	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	hypothetical protein
cueR	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_2144: Copper-responsive transcriptional regulator, MerR family	Sphingopyxis alaskensis RB2256 Gene: Sala_2543: Copper-responsive transcriptional regulator, MerR family	Sphingobium japonicum UT26S Gene: SJA_C1-04820: Copper-responsive transcriptional regulator, MerR family	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Copper-responsive transcriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CueR - Sphingomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --