Regulog CueR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | 1 | 1 |
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | 2 | 1 |
| Chromobacterium violaceum ATCC 12472 | ||
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | ||
| Methylotenera mobilis JLW8 | 4 | 3 |
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| cusC |
|
|
|
|
|
|
|
|
|
|
*
Methylotenera mobilis JLW8 Site: position = -290 score = 5.5509 sequence = ACCTTACAATTGTTGGAAGCT Gene: Mmol_1490: Heavy metal efflux RND outer membrane protein, CzcC family |
|
Heavy metal efflux RND outer membrane protein, CzcC family |
| copA |
|
*
Thauera sp. MZ1T Site: position = -62 score = 5.54571 sequence = ACCTTCCCACGTTGGCAAGGT Gene: Tmz1t_3243: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
*
Thiobacillus denitrificans Site: position = -59 score = 6.02995 sequence = ACCTTGCCATGATGGCAAGGT Gene: Tbd_2266: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
Gene: Mmol_1491: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
|
|
|
|
|
Gene: Tbd_2267: Copper-responsive transcriptional regulator, MerR family |
|
|
|
|
*
Methylotenera mobilis JLW8 Site: position = -156 score = 5.5509 sequence = AGCTTCCAACAATTGTAAGGT Site: position = -107 score = 4.76718 sequence = ACCTTACAATAGTGGAAAGCA Gene: Mmol_1488: Copper-responsive transcriptional regulator, MerR family |
|
Copper-responsive transcriptional regulator, MerR family |
| CRON 2. | |||||||||||||
| copZ |
|
|
|
|
|
|
|
|
|
|
*
Methylotenera mobilis JLW8 Site: position = -115 score = 4.76718 sequence = TGCTTTCCACTATTGTAAGGT Site: position = -66 score = 5.5509 sequence = ACCTTACAATTGTTGGAAGCT Gene: Mmol_1489: Copper chaperone |
|
Copper chaperone |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |