Regulog CueR - Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H	2	1
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145
Idiomarina loihiensis L2TR

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
copA	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	* Colwellia psychrerythraea 34H Site: position = -65 score = 5.02344 sequence = ACCTTACTACCGTGGTAAGCT Gene: CPS_1916: Copper-translocating P-type ATPase (EC 3.6.3.4)	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H Gene: CPS_1915: Copper-responsive transcriptional regulator, MerR family	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Copper-responsive transcriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --