Regulog CueR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Glaciecola sp. HTCC2999 | ||
| Colwellia psychrerythraea 34H | 2 | 1 |
| Alteromonadales bacterium TW-7 | ||
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | ||
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| copA |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -65 score = 5.02344 sequence = ACCTTACTACCGTGGTAAGCT Gene: CPS_1916: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
|
|
|
Gene: CPS_1915: Copper-responsive transcriptional regulator, MerR family |
|
|
|
|
|
Copper-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |