Regulog ZntR - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444
Sphingopyxis alaskensis RB2256	1	1
Sphingobium japonicum UT26S	1	1
Sphingomonas wittichii RW1
Zymomonas mobilis subsp. mobilis ZM4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
zntR	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444	* Sphingopyxis alaskensis RB2256 Site: position = -41 score = 4.71312 sequence = ACCTTGGACCATGGTCCAACCT Gene: Sala_2470: Zinc resistance ranscriptional regulator, MerR family	* Sphingobium japonicum UT26S Site: position = -41 score = 4.08053 sequence = ACCCTGGACCATGGTCCAACCG Gene: SJA_C1-05190: Zinc resistance ranscriptional regulator, MerR family	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Zinc resistance ranscriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --