Regulog ZntR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Zinc resistance |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - ZntR
- By TF family - MerR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | 2 | 1 |
| Moritella sp. PE36 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 1 | 1 |
| Aeromonas salmonicida subsp. salmonicida A449 | 1 | 1 |
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| zntA |
|
|
2
Moritella sp. PE36 Gene: PE36_24208: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) Gene: PE36_22520: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -3 score = 6.26539 sequence = ACCTTGGACTTAACACCAAGGT Gene: AHA_0629: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -84 score = 6.26539 sequence = ACCTTGGACTTAACACCAAGGT Gene: ASA_0629: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
| CRON 2. | |||||||
| zntR |
|
*
Psychromonas sp. CNPT3 Site: position = -73 score = 6.08405 sequence = ACCTTAGATTCAACTCTAAGGT Gene: PCNPT3_08420: Zinc resistance transcriptional regulator, MerR family |
|
Gene: AHA_0842: Zinc resistance transcriptional regulator, MerR family |
Gene: ASA_3450: Zinc resistance transcriptional regulator, MerR family |
|
Zinc resistance transcriptional regulator, MerR family |
| PF03773 |
|
Gene: PCNPT3_08425: Putative permease of unknown function DUF318 |
|
|
|
|
Putative permease of unknown function DUF318 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |