Regulog SmoR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sorbitol utilization; Mannitol utilization |
| Effector: | Mannitol; Sorbitol |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Mannitol
- By effector - Sorbitol
- By pathway - Sorbitol utilization
- By pathway - Mannitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 9 | 2 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | 3 | 2 |
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 2 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 6 | 1 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| SMb21377 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Sinorhizobium meliloti 1021 Site: position = -114 score = 5.48668 sequence = AAATTGACGCGCGGTAAGTT Gene: SMb21377: Ribose/xylose/arabinose/galactoside ABC-type transport systems, substrate-binding component |
|
Ribose/xylose/arabinose/galactoside ABC-type transport systems, substrate-binding component |
| SMb21376 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMb21376: Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 (EC 3.6.3.17) |
|
Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 (EC 3.6.3.17) |
| SMb21375 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMb21375: Ribose/xylose/arabinose/galactoside ABC-type transport systems, permease components |
|
Ribose/xylose/arabinose/galactoside ABC-type transport systems, permease components |
| fruK |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -285 score = 5.20743 sequence = AACAATACATGCGTAAATTT Site: position = -98 score = 6.03487 sequence = ATATTGACGCGCGTAAACTT Gene: Atu3166: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -123 score = 5.00592 sequence = AGAGTTGCGCGCGTCAAATT Gene: mll7216: Fructokinase (EC 2.7.1.4) |
|
|
*
Rhizobium etli CFN 42 Site: position = -289 score = 5.52982 sequence = AAAATTACATGCGTAAACTT Site: position = -114 score = 5.59785 sequence = AAATTGTCACGCGTCAAATT Gene: RHE_PC00220: Fructokinase (EC 2.7.1.4) |
|
|
|
Gene: SMb21374: Fructokinase (EC 2.7.1.4) |
|
Fructokinase (EC 2.7.1.4) |
| agaZ |
Gene: Atu3167: Tagatose 6-phosphate kinase |
|
|
|
|
|
Gene: mll7215: Tagatose 6-phosphate kinase |
|
|
Gene: RHE_PC00221: Tagatose 6-phosphate kinase |
|
|
|
Gene: SMb21373: Tagatose 6-phosphate kinase |
|
Tagatose 6-phosphate kinase |
| smoR |
Gene: Atu3162: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -157 score = 5.00592 sequence = AATTTGACGCGCGCAACTCT Gene: mlr7217: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
|
Gene: RHE_PC00216: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
|
|
Gene: SMb21372: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
|
Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
| smoF |
Gene: Atu3168: ABC transporter, membrane spanning protein (sorbitol/mannitol) |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
ABC transporter, membrane spanning protein (sorbitol/mannitol) |
| smoG |
Gene: Atu3169: ABC transporter, membrane spanning protein (sorbitol/mannitol) |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
ABC transporter, membrane spanning protein (sorbitol/mannitol) |
| smoK |
Gene: Atu3170: ABC transporter, nucleotide binding/ATPase protein (sorbitol/mannitol) |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
ABC transporter, nucleotide binding/ATPase protein (sugar) |
| smoE |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -114 score = 5.20743 sequence = AAATTTACGCATGTATTGTT Gene: Atu3165: ABC transporter, substrate binding protein (sorbitol/mannitol) |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
ABC transporter, substrate binding protein (sorbitol/mannitol) |
| smoS |
Gene: Atu3164: sorbitol dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
sorbitol dehydrogenase |
| Atu3163 |
Gene: Atu3163: zinc-binding dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
zinc-binding dehydrogenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |