Regulog AguR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | |
| Biological process: | Agmatine utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - RpiR
- By pathway - Agmatine utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 6 | 1 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | 7 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 6 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| ptcA |
|
*
Lactobacillus brevis ATCC 367 Site: position = -157 score = 5.61908 sequence = GAATGAAACATGTGTCACCA Gene: LVIS_2210: Putrescine carbamoyltransferase (EC 2.1.3.6) |
|
|
|
|
|
|
|
|
*
Lactobacillus sakei subsp. sakei 23K Site: position = -121 score = 4.80175 sequence = AAATGGAACAAAATACACAT Gene: LSA0067: Putrescine carbamoyltransferase (EC 2.1.3.6) |
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -145 score = 6.23813 sequence = AAATGAAACATGTTTCATGA Gene: PEPE_0189: Putrescine carbamoyltransferase (EC 2.1.3.6) |
Putrescine carbamoyltransferase (EC 2.1.3.6) |
| aguD |
|
Gene: LVIS_2209: Agmatine/putrescine antiporter, associated with agmatine catabolism |
|
|
|
|
|
|
|
|
2
Lactobacillus sakei subsp. sakei 23K Gene: LSA0068: Agmatine/putrescine antiporter, associated with agmatine catabolism Gene: LSA0069: Agmatine/putrescine antiporter, associated with agmatine catabolism |
|
|
|
Gene: PEPE_0190: Agmatine/putrescine antiporter, associated with agmatine catabolism |
Agmatine/putrescine antiporter, associated with agmatine catabolism |
| aguA1 |
|
Gene: LVIS_2208: Agmatine deiminase (EC 3.5.3.12) |
|
|
|
|
|
|
|
|
Gene: LSA0070: Agmatine deiminase (EC 3.5.3.12) |
|
|
|
Gene: PEPE_0191: Agmatine deiminase (EC 3.5.3.12) |
Agmatine deiminase (EC 3.5.3.12) |
| aguC |
|
Gene: LVIS_2207: Carbamate kinase (EC 2.7.2.2) |
|
|
|
|
|
|
|
|
Gene: LSA0071: Carbamate kinase (EC 2.7.2.2) |
|
|
|
Gene: PEPE_0192: Carbamate kinase (EC 2.7.2.2) |
Carbamate kinase (EC 2.7.2.2) |
| aguA2 |
|
Gene: LVIS_2206: Agmatine deiminase (EC 3.5.3.12) |
|
|
|
|
|
|
|
|
Gene: LSA0072: Agmatine deiminase (EC 3.5.3.12) |
|
|
|
Gene: PEPE_0193: Agmatine deiminase (EC 3.5.3.12) |
Agmatine deiminase (EC 3.5.3.12) |
| aguR |
|
Gene: LVIS_2205: Predicted agmatine utilization transcriptional regulator AguR, RpiR family |
|
|
|
|
|
|
|
|
Gene: LSA0073: Predicted agmatine utilization transcriptional regulator AguR, RpiR family |
|
|
|
Gene: PEPE_0194: Predicted agmatine utilization transcriptional regulator AguR, RpiR family |
Predicted agmatine utilization transcriptional regulator AguR, RpiR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |