Regulog PadR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Phenolic acid stress response |
| Effector: | p-Coumaric acid; Ferulic acid |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - PadR
- By effector - p-Coumaric acid
- By effector - Ferulic acid
- By pathway - Phenolic acid stress response
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 2 | 2 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 2 | 2 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | 1 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 2 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| padC |
|
*
Lactobacillus brevis ATCC 367 Site: position = -48 score = 7.11802 sequence = AAACATGTAATTAATTACATGTTC Gene: LVIS_0213: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
|
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -59 score = 7.45816 sequence = AAACATGTAATAAATTACATGATT Gene: lp_3665: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
*
Lactobacillus sakei subsp. sakei 23K Site: position = -41 score = 7.19759 sequence = AAACATGTAATTAATTACATGATA Gene: LSA1701: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = 7 score = 6.40489 sequence = AAACTTTTAAAACTTTAGATGACT Gene: PEPE_0491: Phenolic acid decarboxylase (EC 4.1.1.-) |
Phenolic acid decarboxylase (EC 4.1.1.-) |
| padR |
|
*
Lactobacillus brevis ATCC 367 Site: position = -208 score = 7.09299 sequence = GAACATGTAATTAATTACATGTTT Gene: LVIS_0214: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
|
Gene: LAF_1009: Phenolic acid stress response transcriptional regulator PadR, PadR family |
Gene: lhv_1703: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
*
Lactobacillus plantarum WCFS1 Site: position = -80 score = 6.89693 sequence = AATCATGTAATTTATTACATGTTT Gene: lp_3664: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
|
Gene: LSA0265: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
|
|
Gene: PEPE_0492: Phenolic acid stress response transcriptional regulator PadR, PadR family |
Phenolic acid stress response transcriptional regulator PadR, PadR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |