Regulog ModE - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | ||
| Acinetobacter baumannii AB0057 | 3 | 1 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| modA |
Gene: ACIAD1901: Molybdate ABC transporter, substrate-binding protein |
*
Acinetobacter baumannii AB0057 Site: position = -56 score = 5.91849 sequence = AGCGCTATATTCTTAAGTATATATCGCT Gene: AB57_1980: Molybdate ABC transporter, substrate-binding protein |
Gene: Psyc_0617: Molybdate ABC transporter, substrate-binding protein |
|
Molybdate ABC transporter, substrate-binding protein |
| modB |
Gene: ACIAD1900: Molybdate ABC transporter, permease protein |
Gene: AB57_1981: Molybdate ABC transporter, permease protein |
Gene: Psyc_0618: Molybdate ABC transporter, permease protein |
Gene: PsycPRwf_0223: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modC |
Gene: ACIAD1899: Molybdate ABC transporter, ATP-binding protein |
Gene: AB57_1982: Molybdate ABC transporter, ATP-binding protein |
|
|
Molybdate ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |