Regulog ModE - Moraxellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
modA	Acinetobacter sp. ADP1 Gene: ACIAD1901: Molybdate ABC transporter, substrate-binding protein	* Acinetobacter baumannii AB0057 Site: position = -56 score = 5.91849 sequence = AGCGCTATATTCTTAAGTATATATCGCT Gene: AB57_1980: Molybdate ABC transporter, substrate-binding protein	Psychrobacter arcticum 273-4 Gene: Psyc_0617: Molybdate ABC transporter, substrate-binding protein	Psychrobacter sp. PRwf-1	Molybdate ABC transporter, substrate-binding protein
modB	Acinetobacter sp. ADP1 Gene: ACIAD1900: Molybdate ABC transporter, permease protein	Acinetobacter baumannii AB0057 Gene: AB57_1981: Molybdate ABC transporter, permease protein	Psychrobacter arcticum 273-4 Gene: Psyc_0618: Molybdate ABC transporter, permease protein	Psychrobacter sp. PRwf-1 Gene: PsycPRwf_0223: Molybdate ABC transporter, permease protein	Molybdate ABC transporter, permease protein
modC	Acinetobacter sp. ADP1 Gene: ACIAD1899: Molybdate ABC transporter, ATP-binding protein	Acinetobacter baumannii AB0057 Gene: AB57_1982: Molybdate ABC transporter, ATP-binding protein	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Molybdate ABC transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --