Regulog FruR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - DeoR
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | ||
| Thermotoga sp. RQ2 | 6 | 1 |
| Thermotoga neapolitana DSM 4359 | ||
| Thermotoga petrophila RKU-1 | ||
| Thermotoga naphthophila RKU-10 | 6 | 1 |
| Thermotoga lettingae TMO | ||
| Thermosipho africanus TCF52B | ||
| Thermosipho melanesiensis BI429 | ||
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| fruR |
|
*
Thermotoga sp. RQ2 Site: position = -62 score = 4.1948 sequence = ATCACAATATGTCATAATCAATCATAAAGCGATCACAA Gene: TRQ2_0642: Predicted regulator of fructose utilization, DeoR family |
|
|
*
Thermotoga naphthophila RKU-10 Site: position = -61 score = 4.1948 sequence = ATCATAATACGTCATAATCAGTCATGAACCGATCACAA Gene: Tnap_0927: Predicted regulator of fructose utilization, DeoR family |
|
|
|
|
|
|
Predicted regulator of fructose utilization, DeoR family |
| fruK |
|
Gene: TRQ2_0641: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
Gene: Tnap_0928: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
|
|
|
|
1-phosphofructokinase (EC 2.7.1.56) |
| fruB |
|
Gene: TRQ2_0640: PTS system, fructose-specific IIA component (EC 2.7.1.69) |
|
|
Gene: Tnap_0929: PTS system, fructose-specific IIA component (EC 2.7.1.69) |
|
|
|
|
|
|
PTS system, fructose-specific IIA component (EC 2.7.1.69) |
| fruA |
|
Gene: TRQ2_0639: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
Gene: Tnap_0930: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
|
|
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
| ptsH |
|
Gene: TRQ2_0638: Phosphotransferase system, phosphocarrier protein HPr |
|
|
Gene: Tnap_0931: Phosphotransferase system, phosphocarrier protein HPr |
|
|
|
|
|
|
Phosphotransferase system, phosphocarrier protein HPr |
| ptsI |
|
Gene: TRQ2_0637: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
Gene: Tnap_0932: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
|
|
|
|
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |