Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CueR2 regulog to Shewanella loihica PV-4

Reference regulog properties
Source regulog: CueR2 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella loihica PV-4
Orthologous TF(s) Shew_3819
Regulated genes 1
Built upon 3 sites [see more]
Predicted regulatory interactions in Shewanella loihica PV-4
Locus tag Position Score Sequence
Position: -66
Score: 6.8
Sequence: ACCTGTGTCTAACACACAGGT
Locus tag: Shew_3819
Shew_3819 -66 6.8 ACCTGTGTCTAACACACAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueR2
Ortholog function: Copper-responsive transcriptional regulator, MerR family
Shewanella putrefaciens CN-32 Sputcn32_0271 -66 6.1 AGCTGTGTGTTACACACAGAG
Shewanella frigidimarina NCIMB 400 Sfri_0211 -101 6 ACATGGGTGTAAGACATAGGT
Shewanella loihica PV-4 Shew_3819 -66 6.8 ACCTGTGTCTAACACACAGGT
© 2009-2020 RegPrecise