Propagation of CueR2 regulog to Shewanella loihica PV-4
Source regulog: | CueR2 - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Copper resistance |
Effector: | Copper ion, (Cu+) |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Shewanella loihica PV-4 |
Orthologous TF(s) | Shew_3819 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -66
Score: 6.8 Sequence: ACCTGTGTCTAACACACAGGT
Locus tag: Shew_3819
|
||||
Shew_3819 | -66 | 6.8 | ACCTGTGTCTAACACACAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cueR2 | ||||
Ortholog function: Copper-responsive transcriptional regulator, MerR family | ||||
Shewanella putrefaciens CN-32 | Sputcn32_0271 | -66 | 6.1 | AGCTGTGTGTTACACACAGAG |
Shewanella frigidimarina NCIMB 400 | Sfri_0211 | -101 | 6 | ACATGGGTGTAAGACATAGGT |
Shewanella loihica PV-4 | Shew_3819 | -66 | 6.8 | ACCTGTGTCTAACACACAGGT |