Propagation of SO4468 regulog to Shewanella baltica OS185

Reference regulog properties
Source regulog:	SO4468 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella baltica OS185
Orthologous TF(s)	Shew185_0264
Regulated genes	2

Built upon 22 sites [see more]

Predicted regulatory interactions in *Shewanella baltica OS185*
	Locus tag	Position	Score	Sequence
Position: -104 Score: 5.9 Sequence: TTAGACGACTGGTCTACTAA Locus tag: Shew185_0263
	Shew185_0263	-104	5.9	TTAGACGACTGGTCTACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4469
Ortholog function: Alcohol dehydrogenase, iron-containing
Shewanella oneidensis MR-1	SO_4469	-52	6	CTAGACGACTGGTCTACTAA
Shewanella putrefaciens CN-32	Sputcn32_0377	-64	5.9	TTAGACGACTGGTCTACTAA
Shewanella sp W3-18-1	Sputw3181_0227	-64	5.9	TTAGACGACTGGTCTACTAA
Shewanella sp ANA-3	Shewana3_0261	-52	6	CTAGACGACTGGTCTACTAA
Shewanella sp MR-4	Shewmr4_0260	-51	6	CTAGACGACTGGTCTACTAA
Shewanella sp MR-7	Shewmr7_3761	-51	6	CTAGACGACTGGTCTACTAA
Shewanella baltica OS155	Sbal_0271	-104	5.9	TTAGACGACTGGTCTACTAA
Shewanella piezotolerans WP3	swp_0256	-62	6	CTAGACGACTGGTCTACTAA
Shewanella sediminis HAW-EB3	Ssed_0286	-59	6	CTAGACGACTGGTCTACTAA

Position: -37 Score: 5.6 Sequence: CTAGACGACCGGTCTATTTT Locus tag: Shew185_0264
	Shew185_0264	-37	5.6	CTAGACGACCGGTCTATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4468
Ortholog function: Transcriptional regulator, TetR family
Shewanella oneidensis MR-1	SO_4468	-38	5.6	CTAGACGACTGGTCTAATTT
Shewanella putrefaciens CN-32	Sputcn32_0378	-25	5.7	CTAGACGACCGGTCTAATTT
Shewanella sp W3-18-1	Sputw3181_0228	-25	5.7	CTAGACGACCGGTCTAATTT
Shewanella sp ANA-3	Shewana3_0262	-38	5.8	CTAGACGACTGGTCTAATAT
Shewanella sp MR-4	Shewmr4_0261	-38	5.6	CTAGACGACTGGTCTAATTT
Shewanella sp MR-7	Shewmr7_3760	-38	5.6	CTAGACGACTGGTCTAATTT
Shewanella baltica OS155	Sbal_0272	-37	5.6	CTAGACGACCGGTCTATTTT
Shewanella denitrificans OS217	Sden_1388	-36	5.9	CTAGACGACCGGTCTAATTG
Shewanella amazonensis SB2B	Sama_0476	-37	5.6	CTAGACGACTGGTCTAATCG
Shewanella piezotolerans WP3	swp_0257	-37	5.6	CTAGACGACCGGTCTAATAC
Shewanella sediminis HAW-EB3	Ssed_0287	-36	5.5	CTAGACGACCGGTCTATTCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of SO4468 regulog to Shewanella baltica OS185

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --