Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of BetI regulog to Shewanella baltica OS185

Reference regulog properties
Source regulog: BetI - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Osmotic stress response
Effector: Betaine
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella baltica OS185
Orthologous TF(s) Shew185_1313
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Shewanella baltica OS185
Locus tag Position Score Sequence
Position: -63
Score: 7.5
Sequence: TTAATTGAACGTTCAATTAA
Locus tag: Shew185_1313
Shew185_1313 -63 7.5 TTAATTGAACGTTCAATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: betI
Ortholog function: glycine betaine biosynthesis transcriptional regulator, TetR family
Shewanella baltica OS155 Sbal_1323 -63 7 TGGATTGAACGTTCAATTAA
Shewanella denitrificans OS217 Sden_0713 -46 7.5 TTAATTGAACGTTCAATTAA
Shewanella frigidimarina NCIMB 400 Sfri_1948 -51 7.2 TTAATTGAGCGTTCAATTAA
Shewanella pealeana ATCC 700345 Spea_1009 -97 7.3 TTAATTGAACGTTCAATCAA
Shewanella halifaxensis HAW-EB4 Shal_1059 -96 7.3 TTAATTGAACGTTCAATCAA
Shewanella sediminis HAW-EB3 Ssed_1121 -73 7.5 TTAATTGAACGTTCAATTAA
Shewanella woodyi ATCC 51908 Swoo_1198 -83 7.5 TTAATTGAACGTTCAATTAA
© 2009-2020 RegPrecise