Propagation of BetI regulog to Shewanella piezotolerans WP3

Reference regulog properties
Source regulog:	BetI - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:	Betaine
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella piezotolerans WP3
Orthologous TF(s)	swp_3809
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Shewanella piezotolerans WP3*
	Locus tag	Position	Score	Sequence
Position: -74 Score: 7.5 Sequence: TTAATTGAACGTTCAATTAA Locus tag: swp_3809
	swp_3809	-74	7.5	TTAATTGAACGTTCAATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: betI
Ortholog function: glycine betaine biosynthesis transcriptional regulator, TetR family
Shewanella baltica OS155	Sbal_1323	-63	7	TGGATTGAACGTTCAATTAA
Shewanella denitrificans OS217	Sden_0713	-46	7.5	TTAATTGAACGTTCAATTAA
Shewanella frigidimarina NCIMB 400	Sfri_1948	-51	7.2	TTAATTGAGCGTTCAATTAA
Shewanella pealeana ATCC 700345	Spea_1009	-97	7.3	TTAATTGAACGTTCAATCAA
Shewanella halifaxensis HAW-EB4	Shal_1059	-96	7.3	TTAATTGAACGTTCAATCAA
Shewanella sediminis HAW-EB3	Ssed_1121	-73	7.5	TTAATTGAACGTTCAATTAA
Shewanella woodyi ATCC 51908	Swoo_1198	-83	7.5	TTAATTGAACGTTCAATTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --