Propagation of NsrR regulog to Idiomarina baltica OS145
| Source regulog: | NsrR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Idiomarina baltica OS145 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -61
Score: 4.3 Sequence: AAATACATTTTAAATGTATGA
Locus tag: OS145_08788
|
||||
| OS145_08788 | -61 | 4.3 | AAATACATTTTAAATGTATGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nnrS2 | ||||
| Ortholog function: NnrS protein involved in response to NO | ||||
| Shewanella sp ANA-3 | Shewana3_2362 | -46 | 4.5 | AAGTGCAATTATTATGAAGCT |
| Shewanella denitrificans OS217 | Sden_2837 | -110 | 4.4 | ACAatCATtaTAaATaCcTGT |
| Shewanella frigidimarina NCIMB 400 | Sfri_3037 | -64 | 5.6 | AGATTTATATATTATGCATGT |
| Shewanella pealeana ATCC 700345 | Spea_1227 | -35 | 4.8 | AGCTGTATTTTAAATGCGTGT |
| Shewanella piezotolerans WP3 | swp_3404 | -39 | 4.2 | AggTaCATtaAAaATaCcTGT |