Propagation of ZntR regulog to Shewanella sediminis HAW-EB3

Reference regulog properties
Source regulog:	ZntR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma
Propagated regulon:
Target genome	Shewanella sediminis HAW-EB3
Orthologous TF(s)	Ssed_0445
Regulated genes	1

Built upon 16 sites [see more]

Predicted regulatory interactions in *Shewanella sediminis HAW-EB3*
	Locus tag	Position	Score	Sequence
Position: -73 Score: 7.1 Sequence: ACCTTAGATTTAACTCCAAGGT Locus tag: Ssed_0445
	Ssed_0445	-73	7.1	ACCTTAGATTTAACTCCAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: zntR
Ortholog function: Zinc resistance transcriptional regulator, MerR family
Shewanella oneidensis MR-1	SO_0443	-94	7	ACCTTGGAGTAGGCTCCAAGGT
Shewanella putrefaciens CN-32	Sputcn32_3400	-84	7	ACCTTGGAGTAGGCTCCAAGGT
Shewanella sp W3-18-1	Sputw3181_0543	-84	7	ACCTTGGAGTAGGCTCCAAGGT
Shewanella sp ANA-3	Shewana3_0442	-94	6.8	ACCTTGGAGTAGGCTCTAAGGT
Shewanella sp MR-4	Shewmr4_0446	-95	6.8	ACCTTGGAGTAGGCTCTAAGGT
Shewanella sp MR-7	Shewmr7_3583	-95	6.8	ACCTTGGAGTAGGCTCTAAGGT
Shewanella baltica OS155	Sbal_0421	-96	7	ACCTTGGAGTAGGCTCCAAGGT
Shewanella denitrificans OS217	Sden_3408	-72	7	ACCTTAGATTAAACTCCAAGGT
Shewanella frigidimarina NCIMB 400	Sfri_0494	-64	7.2	ACCTTGGATTAAACTCCAAGGT
Shewanella amazonensis SB2B	Sama_0396	-59	7.2	ACCTTGGATTAAACTCCAAGGT
Shewanella loihica PV-4	Shew_3411	-66	6.9	ACCTTAGATTTAACTCTAAGGT
Shewanella pealeana ATCC 700345	Spea_0433	-125	6.8	ACCTTGGATACAACTCCAAGGT
Shewanella halifaxensis HAW-EB4	Shal_0489	-115	6.8	ACCTTGGATACAACTCCAAGGT
Shewanella piezotolerans WP3	swp_4723	-96	6.8	ACCTTGGATACAACTCCAAGGT
Shewanella sediminis HAW-EB3	Ssed_0445	-73	7.1	ACCTTAGATTTAACTCCAAGGT
Shewanella woodyi ATCC 51908	Swoo_0297	-73	7.1	ACCTTGGATTTAACTCTAAGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --