Propagation of ModE regulog to Shewanella baltica OS223
| Source regulog: | ModE - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor |
| Biological process: | Molybdopterin biosynthesis; Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella baltica OS223 |
| Orthologous TF(s) | Sbal223_0824 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -52
Score: 6.4 Sequence: ATCGATATATAGATTGGTATATAACGAT
Locus tag: Sbal223_0823
|
||||
| Sbal223_0823 | -52 | 6.4 | ATCGATATATAGATTGGTATATAACGAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: modA2 | ||||
| Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) | ||||
| Shewanella oneidensis MR-1 | SO_3863 | -73 | 5.9 | CTCGATATATAGATTGGTATATATCGAT |
| Shewanella sp ANA-3 | Shewana3_0743 | -52 | 5.9 | ACCGATATATAGATTGGTATATAACGAT |
| Shewanella sp MR-4 | Shewmr4_3195 | -52 | 6.4 | ATCGATATATAGATTGGTATATAACGAT |
| Shewanella sp MR-7 | Shewmr7_0769 | -52 | 6.4 | ATCGATATATAGATTGGTATATAACGAT |
| Shewanella baltica OS155 | Sbal_3538 | -52 | 6.4 | ATCGATATATAGATTGGTATATAACGAT |
|
Position: -181
Score: 6.4 Sequence: ATCGTTATATACCAATCTATATATCGAT
Locus tag: Sbal223_0824
|
||||
| Sbal223_0824 | -181 | 6.4 | ATCGTTATATACCAATCTATATATCGAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: modE | ||||
| Ortholog function: Molybdate-responsive transcriptional regulator ModE | ||||
| Shewanella oneidensis MR-1 | SO_3862 | -178 | 5.9 | ATCGATATATACCAATCTATATATCGAG |
| Shewanella sp ANA-3 | Shewana3_0744 | -178 | 5.9 | ATCGTTATATACCAATCTATATATCGGT |
| Shewanella sp MR-4 | Shewmr4_3194 | -178 | 6.4 | ATCGTTATATACCAATCTATATATCGAT |
| Shewanella sp MR-7 | Shewmr7_0770 | -178 | 6.4 | ATCGTTATATACCAATCTATATATCGAT |
| Shewanella baltica OS155 | Sbal_3537 | -446 | 6.4 | ATCGTTATATAccaAtcTATATAtCGAT |