Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO1758 regulog to Shewanella sp ANA-3

Reference regulog properties
Source regulog: SO1758 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella sp ANA-3
Orthologous TF(s) Shewana3_2704
Regulated genes 1
Built upon 11 sites [see more]
Predicted regulatory interactions in Shewanella sp ANA-3
Locus tag Position Score Sequence
Position: -110
Score: 6.7
Sequence: ACTGACATGATGTTGTCAGT
Locus tag: Shewana3_2706
Shewana3_2706 -110 6.7 ACTGACATGATGTTGTCAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1756
Ortholog function: Glyoxalase family protein
Shewanella oneidensis MR-1 SO_1756 -104 6.8 ACTGACATGATGCTGTCAGT
Shewanella putrefaciens CN-32 Sputcn32_1455 -122 7 ACTGACATCATGCTGTCAGT
Shewanella sp W3-18-1 Sputw3181_2647 -122 7 ACTGACATCATGCTGTCAGT
Shewanella sp ANA-3 Shewana3_2706 -110 6.7 ACTGACATGATGTTGTCAGT
Shewanella sp MR-4 Shewmr4_2540 -110 6.7 ACTGACATGATGTTGTCAGT
Shewanella sp MR-7 Shewmr7_2607 -110 6.7 ACTGACATGATGTTGTCAGT
Shewanella baltica OS155 Sbal_1562 -121 7 ACTGACATCATGCTGTCAGT
Shewanella amazonensis SB2B Sama_1190 -114 6.4 GCTGACACCATGTTGTCAGC
Shewanella loihica PV-4 Shew_2543 -105 6.5 ACTGACACTAGGCTGTCAGT
Shewanella sediminis HAW-EB3 Ssed_2787 -71 6.5 ACTGACACTACGCTGTCAGT
Shewanella woodyi ATCC 51908 Swoo_3144 -100 6.8 ACTGACACTATGGTGTCAGT