Propagation of Fur regulog to Psychromonas ingrahamii 37

Reference regulog properties
Source regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Psychromonas ingrahamii 37
Orthologous TF(s)	Ping_0873
Regulated genes	3

Built upon 505 sites [see more]

Predicted regulatory interactions in *Psychromonas ingrahamii 37*
	Locus tag	Position	Score	Sequence
Position: -57 Score: 6.2 Sequence: AAATGATAACAGTTATCATTT Locus tag: Ping_0309
	Ping_0309	-57	6.2	AAATGATAACAGTTATCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4740
Ortholog function: Conserved hypothetical inner membrane protein
Shewanella oneidensis MR-1	SO4740	-60	6	TAATGAGAATTGTTATCATCT
Shewanella putrefaciens CN-32	Sputcn32_3921	-59	6	TAATGAGAATTGTTATCATCT
Shewanella sp W3-18-1	Sputw3181_4047	-59	6	TAATGAGAATTGTTATCATCT
Shewanella sp ANA-3	Shewana3_4124	-60	6	TAATGAGAATTGTTATCATCT
Shewanella sp MR-4	Shewmr4_3919	-60	6	TAATGAGAATTGTTATCATCT
Shewanella sp MR-7	Shewmr7_4011	-60	6	TAATGAGAATTGTTATCATCT
Shewanella baltica OS155	Sbal_4341	-59	6	TAATGAGAATTGTTATCATCT
Shewanella denitrificans OS217	Sden_3706	-50	6	TATTGATAACGATTATCATTT
Shewanella frigidimarina NCIMB 400	Sfri_4031	-46	6	TAATGAGAACTGTTATCATTT
Shewanella amazonensis SB2B	Sama_3636	-50	5.9	AAGTGATAACTATTATCATTT
Shewanella loihica PV-4	Shew_3815	-46	6.5	AAATGATAATAATTATCATTT
Shewanella pealeana ATCC 700345	Spea_4226	-47	5.9	AAATGAGAAGCGTTATCATTT
Shewanella halifaxensis HAW-EB4	Shal_4274	-47	6.3	AAATGATAACCATTATCATTT
Shewanella piezotolerans WP3	swp_5137	-46	6.1	AAATGATAATCGTTATCATCT
Shewanella sediminis HAW-EB3	Ssed_4479	-47	6.1	AGATGAGAATAGTTATCATTT
Shewanella woodyi ATCC 51908	Swoo_4887	-50	6.3	AAATGAGAACCATTATCATTT

Position: -62 Score: 5.9 Sequence: AAATGGTAATGATTATCATTA Position: -56 Score: 5.2 Sequence: TAATGATTATCATTATTATTA Locus tag: Ping_3007
	Ping_3007	-62	5.9	AAATGGTAATGATTATCATTA
		-56	5.2	TAATGATTATCATTATTATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fbpA
Ortholog function: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
Shewanella oneidensis MR-1	SO0744	-76	5.7	AACTGATAACTATTATCATTA
Shewanella putrefaciens CN-32	Sputcn32_3227	-74	5.8	AAGTGATAACTATTATCATTA
Shewanella sp W3-18-1	Sputw3181_0714	-74	5.8	AAGTGATAACTATTATCATTA
Shewanella sp ANA-3	Shewana3_3517	-76	5.7	AACTGATAACTATTATCATTA
Shewanella sp MR-4	Shewmr4_3347	-76	5.7	AACTGATAACTATTATCATTA
Shewanella sp MR-7	Shewmr7_0606	-76	5.7	AACTGATAACTATTATCATTA
Shewanella baltica OS155	Sbal_0812	-76	5.4	AACTGATAAGCATTATCATTA
Shewanella frigidimarina NCIMB 400	Sfri_0636	-67	5.9	AATTGATAACCATTATCAATT
Shewanella amazonensis SB2B	Sama_0666	-57	5.8	TAGTGATAATAATTATCATTA
Shewanella loihica PV-4	Shew_0861	-41	6.1	AATTGATAATTATTATCATTA
Shewanella pealeana ATCC 700345	Spea_0844	-60	5.8	AATTGAGAATTATTATCAGTT
Shewanella halifaxensis HAW-EB4	Shal_0897	-64	5.4	AATTGAGAATTATTATCAGTC
Shewanella piezotolerans WP3	swp_4107	-60	5.2	AATTGAGAACTATTATCAGCA
Shewanella sediminis HAW-EB3	Ssed_0945	-58	5.7	GATTGATAATAATTATCATTA
Shewanella woodyi ATCC 51908	Swoo_0996	-57	5.4	AATTGATAACTATTATCATCG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of Fur regulog to Psychromonas ingrahamii 37

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --