Propagation of CzrA regulog to Bacillus cereus NVH0597-99

Reference regulog properties
Source regulog:	CzrA - Bacillales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus cereus NVH0597-99
Orthologous TF(s)	BcerN_010100022680
Regulated genes	2

Built upon 16 sites [see more]

Predicted regulatory interactions in *Bacillus cereus NVH0597-99*
	Locus tag	Position	Score	Sequence
Position: -44 Score: 6.6 Sequence: TATATGAACAAATATTCATATG Locus tag: BcerN_010100005455
	BcerN_010100005455	-44	6.6	TATATGAACAAATATTCATATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: czcO
Ortholog function: CzcD accessory protein (oxidoreductase)
Bacillus subtilis subsp. subtilis str. 168	BSU26640	-116	7.1	TATATGAACACATGCTCATATA
Bacillus amyloliquefaciens FZB42	RBAM_005610	-106	6.9	TATATGAGCACATAATCATATA
Geobacillus kaustophilus HTA426	GK0582	-48	7	CATATGAACATATGCTCATATA
Bacillus cereus ATCC 14579	BC3447	-44	6	TATATGAACAAATATTCATACG

Position: -45 Score: 6.4 Sequence: TATATGAATAGTTGTTCATATA Locus tag: BcerN_010100022680
	BcerN_010100022680	-45	6.4	TATATGAATAGTTGTTCATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: czrA
Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family
Bacillus cereus ATCC 14579	BC0595	-46	5.7	TATATGAatgatTGtTCATATg

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --