Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YtrA regulog to Bacillus cereus B4264

Reference regulog properties
Source regulog: YtrA - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Ramoplanin resistance
Effector: Ramoplanin
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus cereus B4264
Orthologous TF(s) BCB4264_A4186
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Bacillus cereus B4264
Locus tag Position Score Sequence
Position: -52
Score: 6.4
Sequence: TGTATTACATATAGTAGTACA
Locus tag: BCB4264_A4186
BCB4264_A4186 -52 6.4 TGTATTACATATAGTAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Transcriptional regulator, GntR family
Bacillus subtilis subsp. subtilis str. 168 BSU30460 -244 6.5 TGTACTAATTGAAGTAATACA
Bacillus amyloliquefaciens FZB42 RBAM_027400 -238 6.7 TGTACTACTTGATGTAATACA
Bacillus pumilus SAFR-032 BPUM_2677 -234 6.4 TGTACTACATCAACTAATACA
Bacillus licheniformis DSM 13 BLi03185 -223 6.4 TGTACTACATCGAGTAATACA
Geobacillus kaustophilus HTA426 GK1620 -49 5.9 TGTACTATTAGTTATAGTACG
Bacillus cereus ATCC 14579 BC4076 -46 6.4 TGTATTACATATAGTAGTACA