Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YhcF regulog to Bacillus cereus AH1134

Reference regulog properties
Source regulog: YhcF - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus cereus AH1134
Orthologous TF(s) BcerAH1_010100017838, BcerAH1_010100025038, BcerAH1_010100006828
Regulated genes 3
Built upon 6 sites [see more]
Predicted regulatory interactions in Bacillus cereus AH1134
Locus tag Position Score Sequence
Position: -42
Score: 6
Sequence: GTGTACTATTTGTCTAGTACAC
Locus tag: BcerAH1_010100006828
BcerAH1_010100006828 -42 6 GTGTACTATTTGTCTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579 BC1356 -43 6.9 GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2 Pjdr2_3930 -44 5.5 GTGTACTATTCAACTATAACAC
Position: -42
Score: 5.9
Sequence: GTGTATTATTCATCTAGTACAC
Locus tag: BcerAH1_010100017838
BcerAH1_010100017838 -42 5.9 GTGTATTATTCATCTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579 BC1356 -43 6.9 GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2 Pjdr2_3930 -44 5.5 GTGTACTATTCAACTATAACAC
Position: -43
Score: 6.4
Sequence: GTGTATTATTCAACTAGTACAC
Locus tag: BcerAH1_010100025038
BcerAH1_010100025038 -43 6.4 GTGTATTATTCAACTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579 BC1356 -43 6.9 GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2 Pjdr2_3930 -44 5.5 GTGTACTATTCAACTATAACAC