Propagation of YhcF regulog to Bacillus cereus AH1134

Reference regulog properties
Source regulog:	YhcF - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus cereus AH1134
Orthologous TF(s)	BcerAH1_010100017838, BcerAH1_010100025038, BcerAH1_010100006828
Regulated genes	3

Built upon 6 sites [see more]

Predicted regulatory interactions in *Bacillus cereus AH1134*
	Locus tag	Position	Score	Sequence
Position: -42 Score: 6 Sequence: GTGTACTATTTGTCTAGTACAC Locus tag: BcerAH1_010100006828
	BcerAH1_010100006828	-42	6	GTGTACTATTTGTCTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579	BC1356	-43	6.9	GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2	Pjdr2_3930	-44	5.5	GTGTACTATTCAACTATAACAC

Position: -42 Score: 5.9 Sequence: GTGTATTATTCATCTAGTACAC Locus tag: BcerAH1_010100017838
	BcerAH1_010100017838	-42	5.9	GTGTATTATTCATCTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579	BC1356	-43	6.9	GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2	Pjdr2_3930	-44	5.5	GTGTACTATTCAACTATAACAC

Position: -43 Score: 6.4 Sequence: GTGTATTATTCAACTAGTACAC Locus tag: BcerAH1_010100025038
	BcerAH1_010100025038	-43	6.4	GTGTATTATTCAACTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579	BC1356	-43	6.9	GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2	Pjdr2_3930	-44	5.5	GTGTACTATTCAACTATAACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --