Propagation of CzrA regulog to Bacillus cereus AH1134
Source regulog: | CzrA - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus cereus AH1134 |
Orthologous TF(s) | BcerAH1_010100004258 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -45
Score: 5.7 Sequence: TATATGAATGATTGTTCATATG
Locus tag: BcerAH1_010100004258
|
||||
BcerAH1_010100004258 | -45 | 5.7 | TATATGAATGATTGTTCATATG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: czrA | ||||
Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family | ||||
Bacillus cereus ATCC 14579 | BC0595 | -46 | 5.7 | TATATGAatgatTGtTCATATg |
Position: -42
Score: 6.6 Sequence: TATATGAACAAATATTCATATG
Locus tag: BcerAH1_010100009428
|
||||
BcerAH1_010100009428 | -42 | 6.6 | TATATGAACAAATATTCATATG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: czcO | ||||
Ortholog function: CzcD accessory protein (oxidoreductase) | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU26640 | -116 | 7.1 | TATATGAACACATGCTCATATA |
Bacillus amyloliquefaciens FZB42 | RBAM_005610 | -106 | 6.9 | TATATGAGCACATAATCATATA |
Geobacillus kaustophilus HTA426 | GK0582 | -48 | 7 | CATATGAACATATGCTCATATA |
Bacillus cereus ATCC 14579 | BC3447 | -44 | 6 | TATATGAACAAATATTCATACG |