Propagation of YhcF regulog to Bacillus cereus AH187
| Source regulog: | YhcF - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus cereus AH187 |
| Orthologous TF(s) | BCAH187_A1514 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -43
Score: 6.9 Sequence: GTGTATTATTTAACTAGTACAC
Locus tag: BCAH187_A1514
|
||||
| BCAH187_A1514 | -43 | 6.9 | GTGTATTATTTAACTAGTACAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yhcF | ||||
| Ortholog function: Transcriptional regulator, GntR family | ||||
| Bacillus cereus ATCC 14579 | BC1356 | -43 | 6.9 | GTGTATTATTTAACTAGTACAC |
| Paenibacillus sp. JDR-2 | Pjdr2_3930 | -44 | 5.5 | GTGTACTATTCAACTATAACAC |