Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YhcF regulog to Bacillus anthracis Tsiankovskii-I

Reference regulog properties
Source regulog: YhcF - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus anthracis Tsiankovskii-I
Orthologous TF(s) BantT_010100024407
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Bacillus anthracis Tsiankovskii-I
Locus tag Position Score Sequence
Position: -43
Score: 6.9
Sequence: GTGTATTATTTAACTAGTACAC
Locus tag: BantT_010100024407
BantT_010100024407 -43 6.9 GTGTATTATTTAACTAGTACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcF
Ortholog function: Transcriptional regulator, GntR family
Bacillus cereus ATCC 14579 BC1356 -43 6.9 GTGTATTATTTAACTAGTACAC
Paenibacillus sp. JDR-2 Pjdr2_3930 -44 5.5 GTGTACTATTCAACTATAACAC