Propagation of YdfD/YisV regulog to Bacillus anthracis Tsiankovskii-I
Source regulog: | YdfD/YisV - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/MocR |
Regulation mode: | repressor (activator) |
Biological process: | Metabolite transport |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus anthracis Tsiankovskii-I |
Orthologous TF(s) | BantT_010100005170 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -113
Score: 7 Sequence: TGGTTGGTTTTTACGATAAAAAACTGGTTGA
Locus tag: BantT_010100005160
|
||||
BantT_010100005160 | -113 | 7 | TGGTTGGTTTTTACGATAAAAAACTGGTTGA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ydfC | ||||
Ortholog function: Permease of the drug/metabolite transporter (DMT) superfamily | ||||
Bacillus cereus ATCC 14579 | BC2681 | -116 | 6.6 | TGGTTGGTTTTTCCGATAAATAACTGGTTGA |