Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Bacillus anthracis Tsiankovskii-I

Reference regulog properties
Source regulog: NiaR - Bacillales
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus anthracis Tsiankovskii-I
Orthologous TF(s) BantT_010100016487
Regulated genes 3
Built upon 26 sites [see more]
Predicted regulatory interactions in Bacillus anthracis Tsiankovskii-I
Locus tag Position Score Sequence
Position: -126
Score: 6.2
Sequence: TTCAACTGTCTTGACACCTATA
Locus tag: BantT_010100016492
BantT_010100016492 -126 6.2 TTCAACTGTCTTGACACCTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nifS
Ortholog function: Cysteine desulfurase (EC 2.8.1.7)
Bacillus subtilis subsp. subtilis str. 168 BSU27880 -83 6.5 TACACCTGTCTTGACACCTATA
Bacillus amyloliquefaciens FZB42 RBAM_024930 -84 6.5 TACACCTGTCTTGACACCTATA
Bacillus licheniformis DSM 13 BLi02915 -80 6.6 TACATGTGTCTTGACACCTATA
Anoxybacillus flavithermus WK1 Aflv_0702 -41 5.5 TCATACTGTCTTGACACCTATA
-29 4.4 GACACCTATATTGACATATATT
Geobacillus kaustophilus HTA426 GK2602 -86 6.1 TTCACCTGTCTTGACATCTATA
Bacillus cereus ATCC 14579 BC4424 -127 6.2 TCCAACTGTCTTGACACCTATA
Bacillus halodurans C-125 BH1217 -102 6.4 TACATATGTCTTGACATCTATA
Bacillus clausii KSM-K16 ABC1546 -73 6.1 TACAGTTGTCTTGTCACCTATA
Position: -47
Score: 6.2
Sequence: TATAGGTGTCAAGACAGTTGAA
Locus tag: BantT_010100016497
BantT_010100016497 -47 6.2 TATAGGTGTCAAGACAGTTGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nadB
Ortholog function: L-aspartate oxidase (EC 1.4.3.16)
Anoxybacillus flavithermus WK1 Aflv_0703 -49 4.4 AATATATGTCAATATAGGTGTC
-37 5.5 TATAGGTGTCAAGACAGTATGA
Geobacillus kaustophilus HTA426 GK2601 -41 6.1 TATAGATGTCAAGACAGGTGAA
Bacillus cereus ATCC 14579 BC4423 -47 6.2 TATAGGTGTCAAGACAGTTGGA
Position: -37
Score: 4.7
Sequence: ATGATGTGTAAAGACAGCTGTG
Locus tag: BantT_010100020686
BantT_010100020686 -37 4.7 ATGATGTGTAAAGACAGCTGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaP
Ortholog function: Niacin transporter NiaP
Bacillus subtilis subsp. subtilis str. 168 BSU02950 -63 5 ACAATGTGTAAAGACAGGTGTA
Bacillus amyloliquefaciens FZB42 RBAM_003210 -61 5 ACAATGTGTAAAGACAGGTGTA
Bacillus licheniformis DSM 13 BLi00841 -71 5.4 CAAAAGTGTAAAGACAGGTGTA
Geobacillus kaustophilus HTA426 GK3433 -39 5.2 TAAATATGTCTTTACATTGATA
Bacillus cereus ATCC 14579 BC5418 -37 4.7 ATGATGTGTAAAGACACCTGTG