Propagation of MsmR regulog to Bacillus licheniformis DSM 13
| Source regulog: | MsmR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus licheniformis DSM 13 |
| Orthologous TF(s) | BLi01139 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -77
Score: 4.6 Sequence: TATTGAAAACTTTTACCTTG
Locus tag: BLi01139
|
||||
| BLi01139 | -77 | 4.6 | TATTGAAAACTTTTACCTTG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: msmR | ||||
| Ortholog function: Transcriptional regulator of alpha-galactoside utilization, LacI family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU30260 | -88 | 5.5 | TATTGTAACCGCTTACTTTT |
| Bacillus amyloliquefaciens FZB42 | RBAM_027180 | -93 | 5.4 | TGTTGAAAACGCTTACTCTC |
| Bacillus pumilus SAFR-032 | BPUM_1754 | -80 | 4.4 | ACTTGAAAGCGCTTTACCAA |
| Bacillus licheniformis DSM 13 | BLi01139 | -77 | 4.6 | TATTGAAAACTTTTACCTTG |
| Bacillus halodurans C-125 | BH2227 | -97 | 5.8 | TATTGAAAACGCTTACCCTA |
|
Position: -53
Score: 4.9 Sequence: AAATGAAAGCGCTTTTTATT
Locus tag: BLi01140
|
||||
| BLi01140 | -53 | 4.9 | AAATGAAAGCGCTTTTTATT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: msmE | ||||
| Ortholog function: Multiple sugar ABC transporter, stachyose-binding protein | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU30270 | -88 | 5.5 | TATTGTAACCGCTTACTTTT |
| Bacillus amyloliquefaciens FZB42 | RBAM_027190 | -93 | 5.4 | TGTTGAAAACGCTTACTCTC |
| Bacillus pumilus SAFR-032 | BPUM_1753 | -80 | 4.4 | ACTTGAAAGCGCTTTACCAA |
| Bacillus licheniformis DSM 13 | BLi01140 | -53 | 4.9 | AAATGAAAGCGCTTTTTATT |
| Bacillus halodurans C-125 | BH2226 | -97 | 5.8 | TATTGAAAACGCTTACCCTA |