Propagation of CzrA regulog to Bacillus licheniformis DSM 13
| Source regulog: | CzrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus licheniformis DSM 13 |
| Orthologous TF(s) | BLi02201 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -45
Score: 6.6 Sequence: AATATGAATACATGATCATATA
Locus tag: BLi03452
|
||||
| BLi03452 | -45 | 6.6 | AATATGAATACATGATCATATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: czcD | ||||
| Ortholog function: Cation diffusion facilitator family transporter | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU26650 | -116 | 7.1 | TATATGAACACATGCTCATATA |
| Bacillus amyloliquefaciens FZB42 | RBAM_005600 | -106 | 6.9 | TATATGAGCACATAATCATATA |
| Bacillus licheniformis DSM 13 | BLi03452 | -45 | 6.6 | AATATGAATACATGATCATATA |
| Geobacillus kaustophilus HTA426 | GK1407 | -43 | 7.1 | TATATGAACAAATGCTCATATA |
| Geobacillus kaustophilus HTA426 | GK0581 | -48 | 7 | CATATGAACATATGCTCATATA |
| Bacillus clausii KSM-K16 | ABC3389 | -36 | 6.8 | AATATGAACATATAATCATATA |
| Oceanobacillus iheyensis HTE831 | OB1399 | -39 | 6.7 | AATATGAGCATATGATCATATT |
| Paenibacillus sp. JDR-2 | Pjdr2_0376 | -44 | 6.1 | CATATGAATAGTTGTTCATATA |
|
Position: -61
Score: 6.9 Sequence: TATATGCGTATATGCTCATATA
Locus tag: BLi03539
|
||||
| BLi03539 | -61 | 6.9 | TATATGCGTATATGCTCATATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cadA | ||||
| Ortholog function: Cadmium-transporting ATPase (EC 3.6.3.3) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU33490 | -94 | 7.3 | TATATGAGTATATGCTCATATA |
| Bacillus amyloliquefaciens FZB42 | RBAM_030670 | -87 | 7.3 | TATATGAGTATATGTTCATATA |
| Bacillus pumilus SAFR-032 | BPUM_3010 | -87 | 7.3 | TATATGAATATATGCTCATATA |
| Bacillus licheniformis DSM 13 | BLi03539 | -61 | 6.9 | TATATGCGTATATGCTCATATA |
| Bacillus cereus ATCC 14579 | BC0596 | -46 | 5.7 | TATATGAatgatTGtTCATATg |