Propagation of SdpR regulog to Bacillus licheniformis DSM 13
| Source regulog: | SdpR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Toxin-antitoxin system |
| Effector: | SdpI, signal transduction protein |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus licheniformis DSM 13 |
| Orthologous TF(s) | BLi00787 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -42
Score: 6.3 Sequence: ATTTAGTTAAATAACTAAAT
Locus tag: BLi00787
|
||||
| BLi00787 | -42 | 6.3 | ATTTAGTTAAATAACTAAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: sdpR | ||||
| Ortholog function: Transcriptional regulator of SdpC resistance operon | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU33790 | -53 | 6.2 | ATTTATACAAATATCTAAAT |
| Bacillus licheniformis DSM 13 | BLi00787 | -42 | 6.3 | ATTTAGTTAAATAACTAAAT |
| Anoxybacillus flavithermus WK1 | Aflv_1587 | -71 | 6.1 | AATTAGAAATTTGTCTAAAT |
| -32 | 6.4 | ATTTAGAAATTTGTCTAAAT | ||
| Geobacillus kaustophilus HTA426 | GK2134 | -148 | 5.4 | ATTTAGATGTTTTTCTAAAC |
| Bacillus cereus ATCC 14579 | BC4834 | -47 | 6.1 | GTTTAGATAAATATCTAAAT |
| Bacillus halodurans C-125 | BH0945 | -42 | 5.9 | ATTTAAGTAATTGCTTAAAT |
| Paenibacillus sp. JDR-2 | Pjdr2_5471 | -54 | 6.4 | ATTTAGAATATTATCTAAAT |