Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SdpR regulog to Bacillus licheniformis DSM 13

Reference regulog properties
Source regulog: SdpR - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Toxin-antitoxin system
Effector: SdpI, signal transduction protein
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus licheniformis DSM 13
Orthologous TF(s) BLi00787
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Bacillus licheniformis DSM 13
Locus tag Position Score Sequence
Position: -42
Score: 6.3
Sequence: ATTTAGTTAAATAACTAAAT
Locus tag: BLi00787
BLi00787 -42 6.3 ATTTAGTTAAATAACTAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdpR
Ortholog function: Transcriptional regulator of SdpC resistance operon
Bacillus subtilis subsp. subtilis str. 168 BSU33790 -53 6.2 ATTTATACAAATATCTAAAT
Bacillus licheniformis DSM 13 BLi00787 -42 6.3 ATTTAGTTAAATAACTAAAT
Anoxybacillus flavithermus WK1 Aflv_1587 -71 6.1 AATTAGAAATTTGTCTAAAT
-32 6.4 ATTTAGAAATTTGTCTAAAT
Geobacillus kaustophilus HTA426 GK2134 -148 5.4 ATTTAGATGTTTTTCTAAAC
Bacillus cereus ATCC 14579 BC4834 -47 6.1 GTTTAGATAAATATCTAAAT
Bacillus halodurans C-125 BH0945 -42 5.9 ATTTAAGTAATTGCTTAAAT
Paenibacillus sp. JDR-2 Pjdr2_5471 -54 6.4 ATTTAGAATATTATCTAAAT