Propagation of NagR regulog to Bacillus licheniformis DSM 13
Source regulog: | NagR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | N-acetylglucosamine utilization |
Effector: | N-acetylglucosamine-6-phosphate |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus licheniformis DSM 13 |
Orthologous TF(s) | BLi04350 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -72
Score: 6.1 Sequence: TTATTGGTCTAGACAACTAG
Locus tag: BLi04348
|
||||
BLi04348 | -72 | 6.1 | TTATTGGTCTAGACAACTAG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: nagA | ||||
Ortholog function: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU35010 | -72 | 5.6 | CAGCTGGTCTAGATCACTAG |
Bacillus amyloliquefaciens FZB42 | RBAM_032200 | -73 | 6.2 | TAACTGGTCTAGATAACTAG |
Bacillus pumilus SAFR-032 | BPUM_3138 | -71 | 5.8 | TTACTGGTATAGACAACTAT |
Bacillus licheniformis DSM 13 | BLi04348 | -72 | 6.1 | TTATTGGTCTAGACAACTAG |
Geobacillus kaustophilus HTA426 | GK2277 | -63 | 5.8 | TTAGTGGTATAGACAACTAG |
Bacillus cereus ATCC 14579 | BC4055 | -99 | 6.4 | TAGAATGTATAGACAACTAC |
Bacillus halodurans C-125 | BH0421 | -157 | 5.2 | AAATTGGTATATACAAATTA |
Bacillus clausii KSM-K16 | ABC1489 | -79 | 6.5 | TAATTGGTATAGACAACTAA |