Propagation of BmrR regulog to Bacillus licheniformis DSM 13
| Source regulog: | BmrR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus licheniformis DSM 13 |
| Orthologous TF(s) | BLi02784 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -257
Score: 7.2 Sequence: GACCCTATAGTTGCTATAGGGTT
Locus tag: BLi02783
|
||||
| BLi02783 | -257 | 7.2 | GACCCTATAGTTGCTATAGGGTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: BLi02783 | ||||
| Ortholog function: Flavoredoxin | ||||
| Bacillus licheniformis DSM 13 | BLi02783 | -257 | 7.2 | GACCCTATAGTTGCTATAGGGTT |