Propagation of GudR regulog to Bacillus licheniformis DSM 13
| Source regulog: | GudR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Glucarate utilization; Galactarate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus licheniformis DSM 13 |
| Orthologous TF(s) | BLi00288 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -119
Score: 7 Sequence: TTTATTTGTCTTACAATTAAA
Locus tag: BLi00284
|
||||
| BLi00284 | -119 | 7 | TTTATTTGTCTTACAATTAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: kdgD | ||||
| Ortholog function: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU02460 | -117 | 7 | TTTATTTGTCTTACAATTAAA |
| Bacillus licheniformis DSM 13 | BLi00284 | -119 | 7 | TTTATTTGTCTTACAATTAAA |
| Bacillus clausii KSM-K16 | ABC0471 | -51 | 6.5 | TTAATTTGTCTTACAATAAAA |
| Oceanobacillus iheyensis HTE831 | OB2841 | -90 | 6.6 | TTTATTTGTCGGACAAATAAA |